Exonuclease 1 (EXO1) (NM_130398) Human 3' UTR Clone

CAT#: SC204772

3`UTR clone of exonuclease 1 (EXO1) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: EXO1
• Synonyms: HEX1; hExoI
• ACCN: NM_130398
• Insert Size: 370
• Sequence Data:
  Insert Sequence

  >SC204772 3'UTR clone of NM_130398
  The sequence shown below is from the reference sequence of NM_130398. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CCTGAATGTGGCCGTGTTCAAAGAGCAATATTCCAGTAAATGCAGACTGCTGCAAAGCTTTTGCCTGCAA
  GAGAATCTGATCAATTTGAAGTCCCTGTTTGGGAATGAGGCACTTATCAGCATGAAGAATTTTTTCTCAT
  TCTGTGCCATTTTAAAAATAGAATACATTTTGTATATTAACTTTATAATTGGGTTGTGGTTTTTTTGCTC
  AGCTTTTTATATTTTTATAAGAAGCTAAATAGAAGAATAATTGTATCTCTGACAGGTTTTTGGAGGTTTT
  AGTGTTAATTGGGAAAATCCTCTGGAGTTTATAAAAGTCTACTCTAAATATTTCTGTAATGTTGTCAAGT
  AGAAAGATAGTAAATGGAGA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_130398.3
• Summary: This gene encodes a protein with 5' to 3' exonuclease activity as well as an RNase H activity. It is similar to the Saccharomyces cerevisiae protein Exo1 which interacts with Msh2 and which is involved in mismatch repair and recombination. Alternative splicing of this gene results in three transcript variants encoding two different isoforms. [provided by RefSeq, Jul 2008]
• Locus ID: 9156