APEX2 (NM_014481) Human 3' UTR Clone

CAT#: SC204804

3`UTR clone of APEX nuclease (apurinic/apyrimidinic endonuclease) 2 (APEX2) nuclear gene encoding mitochondrial protein for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: APEX2
• Synonyms: APE2; APEXL2; XTH2; ZGRF2
• ACCN: NM_014481
• Insert Size: 373
• Sequence Data:
  Insert Sequence

  >SC204804 3'UTR clone of NM_014481
  The sequence shown below is from the reference sequence of NM_014481. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GGTGCAACTTCTTCCTCTGGAGCAGGCCCAGCTGAACCAATGGAGGCCTGGGGACATCTGGCATGGTCAC
  CCCTGCACATGATCTGAGGCCAGCTCCCCTTCCCTGAGCTGCCTCCTGCTTCTCCCTCAAAGTCTCCTAC
  CCTTCTCTTCCTCTTTTAAGCCCTCTCTTCCTCGCTTTCCTTCCTACCTAGCTCCTTGTTGGTGAGCTTC
  TTGTGCCTTAATCCTGTGACCCAGCCCCTTACACCACTTTCCACCTTCCTGTCCGAAGTACACGGACACT
  AGCTGCCCCAGGAAGTTGTGTGATTTTAAATCACTTCTGTCTTTGCTGGAAAGTGTATTTGTGCATAAAT
  AAAGTCTGTGTATTTGTTTCAGG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_014481.2
• Summary: Apurinic/apyrimidinic (AP) sites occur frequently in DNA molecules by spontaneous hydrolysis, by DNA damaging agents or by DNA glycosylases that remove specific abnormal bases. AP sites are pre-mutagenic lesions that can prevent normal DNA replication so the cell contains systems to identify and repair such sites. Class II AP endonucleases cleave the phosphodiester backbone 5' to the AP site. This gene encodes a protein shown to have a weak class II AP endonuclease activity. Most of the encoded protein is located in the nucleus but some is also present in mitochondria. This protein may play an important role in both nuclear and mitochondrial base excision repair. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2012]
• Locus ID: 27301