PI 3 Kinase catalytic subunit alpha (PIK3CA) (NM_006218) Human 3' UTR Clone

CAT#: SC204844

3`UTR clone of phosphoinositide-3-kinase catalytic alpha polypeptide (PIK3CA) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: PIK3CA
• Synonyms: CLAPO; CLOVE; CWS5; MCAP; MCM; MCMTC; p110-alpha; PI3K; PI3K-alpha
• ACCN: NM_006218
• Insert Size: 368 bp
• Sequence Data:
  Insert Sequence

  >SC204844 3'UTR clone of NM_006218
  The sequence shown below is from the reference sequence of NM_006218. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CCACACAATTAAACAGCATGCATTGAACTGAAAAGATAACTGAGAAAATGAAAGCTCACTCTGGATTCCA
  CACTGCACTGTTAATAACTCTCAGCAGGCAAAGACCGATTGCATAGGAATTGCACAATCCATGAACAGCA
  TTAGAATTTACAGCAAGAACAGAAATAAAATACTATATAATTTAAATAATGTAAACGCAAACAGGGTTTG
  ATAGCACTTAAACTAGTTCATTTCAAAATTAAGCTTTAGAATAATGCGCAATTTCATGTTATGCCTTAAG
  TCCAAAAAGGTAAACTTTGAAGATTGTTTGTATCTTTTTTTAAAAAACAAAACAAAACAAAAATCCCCAA
  AATATATAGAAATGATGG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_006218.2
• Summary: 'Phosphatidylinositol 3-kinase is composed of an 85 kDa regulatory subunit and a 110 kDa catalytic subunit. The protein encoded by this gene represents the catalytic subunit, which uses ATP to phosphorylate PtdIns, PtdIns4P and PtdIns(4,5)P2. This gene has been found to be oncogenic and has been implicated in cervical cancers. A pseudogene of this gene has been defined on chromosome 22. [provided by RefSeq, Apr 2016]'
• Locus ID: 5290