PPAP2C (PLPP2) (NM_003712) Human 3' UTR Clone

CAT#: SC204858

3`UTR clone of phosphatidic acid phosphatase type 2C (PPAP2C) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: PLPP2
• Synonyms: LPP2; PAP-2c; PAP2-g; PPAP2C
• ACCN: NM_003712
• Insert Size: 374
• Sequence Data:
  Insert Sequence

  >SC204858 3'UTR clone of NM_003712
  The sequence shown below is from the reference sequence of NM_003712. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  ACCACTATGGATACCCGCACTCCTCCTCCTGAGGCCGGACCCCGCCCAGGCAGGGAGCTGCTGTGAGTCC
  AGCTGAGGCCCACCCAGGTGGTCCCTCCAGCCCTGGTTAGGCACTGAGGGCTCTGGACGGGCTCCAGGAA
  CCCTGGGCTGATGGGAGCAGTGAGCGGGCTCCGCTGCCCCCTGCCCTGCACTGGACCAGGAGTCTGGAGA
  TGCCTGGGTAGCCCTCAGCATTTGGAGGGGAACCTGTTCCCGTCGGTCCCCAAATATCCCCTTCTTTTTA
  TGGGGTTAAGGAAGGGACCGAGAGATCAGATAGTTGCTGTTTTGTAAAATGTAATGTATATGTGGTTTTT
  AGTAAAATAGGGCACCTGTTTCAC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_003712.2
• Summary: The protein encoded by this gene is a member of the phosphatidic acid phosphatase (PAP) family. PAPs convert phosphatidic acid to diacylglycerol, and function in de novo synthesis of glycerolipids as well as in receptor-activated signal transduction mediated by phospholipase D. This protein is similar to phosphatidic acid phosphatase type 2A (PPAP2A) and type 2B (PPAP2B). All three proteins contain 6 transmembrane regions, and a consensus N-glycosylation site. This protein has been shown to possess membrane associated PAP activity. Three alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
• Locus ID: 8612