IGBP1 (NM_001551) Human 3' UTR Clone

CAT#: SC204862

3`UTR clone of immunoglobulin (CD79A) binding protein 1 (IGBP1) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: IGBP1
• Synonyms: ALPHA-4; IBP1
• ACCN: NM_001551
• Insert Size: 364 bp
• Sequence Data:
  Insert Sequence

  >SC204862 3'UTR clone of NM_001551
  The sequence shown below is from the reference sequence of NM_001551. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GCTATGGGAACCGACAGAACATGGGCTGATCTTCCCACAACACCACAGGACTGCAGGGTGCACAACTCCC
  CTGCCAAGGAAAACCATGCAGTCCTCCCCTCCCTGGTCTCCTGCTTCAGCTCTGTACAACGAGGGCAAAG
  ATGCTAAATCTTGCTTTGCATTCAGTAAAGTGTCAAGTGATTAAGTGTGTATTTGTACCCTAGATGATAT
  GAACCAGCAGTCTTGTTTTGGCATCATCCTCATCATGTTGTATTCCAGCTTCTTAAGTGGAAGGAAAAGA
  GTGCTGAGAAATGGCTCTGTATAATCTATGGCTATCCGAATTCTCTGAAAAAATAATAAAAGTCCCCTCT
  ATTATATGAGCCTG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001551.2
• Summary: 'The proliferation and differentiation of B cells is dependent upon a B-cell antigen receptor (BCR) complex. Binding of antigens to specific B-cell receptors results in a tyrosine phosphorylation reaction through the BCR complex and leads to multiple signal transduction pathways. [provided by RefSeq, Jul 2008]'
• Locus ID: 3476