Albumin (ALB) (NM_000477) Human 3' UTR Clone

CAT#: SC204864

3`UTR clone of albumin (ALB) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ALB
• Synonyms: HSA; PRO0883; PRO0903; PRO1341
• ACCN: NM_000477
• Insert Size: 343 bp
• Sequence Data:
  Insert Sequence

  >SC204864 3'UTR clone of NM_000477
  The sequence shown below is from the reference sequence of NM_000477. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AGTCAAGCTGCCTTAGGCTTATAACATCACATTTAAAAGCATCTCAGCCTACCATGAGAATAAGAGAAAG
  AAAATGAAGATCAAAAGCTTATTCATCTGTTTTTCTTTTTCGTTGGTGTAAAGCCAACACCCTGTCTAAA
  AAACATAAATTTCTTTAATCATTTTGCCTCTTTTCTCTGTGCTTCAATTAATAAAAAATGGAAAGAATCT
  AATAGAGTGGTACAGCACTGTTATTTTTCAAAGATGTGTTGCTATCCTGAAAATTCTGTAGGTTCTGTGG
  AAGTTCCAGTGTTCTCTCTTATTCCACTTCGGTAGAGGATTTCTAGTTTCTTGTGGGCTAATT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_000477.5
• Summary: 'This gene encodes the most abundant protein in human blood. This protein functions in the regulation of blood plasma colloid osmotic pressure and acts as a carrier protein for a wide range of endogenous molecules including hormones, fatty acids, and metabolites, as well as exogenous drugs. Additionally, this protein exhibits an esterase-like activity with broad substrate specificity. The encoded preproprotein is proteolytically processed to generate the mature protein. A peptide derived from this protein, EPI-X4, is an endogenous inhibitor of the CXCR4 chemokine receptor. [provided by RefSeq, Jul 2016]'
• Locus ID: 213