C9orf95 (NMRK1) (NM_017881) Human 3' UTR Clone

CAT#: SC204868

3`UTR clone of chromosome 9 open reading frame 95 (C9orf95) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: NMRK1
• Synonyms: bA235O14.2; C9orf95; NRK1
• ACCN: NM_017881
• Insert Size: 346
• Sequence Data:
  Insert Sequence

  >SC204868 3'UTR clone of NM_017881
  The sequence shown below is from the reference sequence of NM_017881. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GTGTTTGCAAGTGACAGCATAAAGACGGAACACAACAAATCCTTCCTGAAGTGAATTAGGAAACTCCAAG
  GAGTAATTTAAGAACCTTCACCAAGATACAATGTATACTGTGGTACAATGACAGCCATTGTTTCATATGT
  TTGATTTTTATTGCACATGGTTTTCCCAACATGTGGAACAATAAATATCCATGCCAATGGACAGGACTGT
  ACCTTAGCAAGTTGCTCCCTCTCCAGGGAGCGCATAGATACAGCAGAGCTCACAGTGAGTCAGAAAGTCT
  CCACTTTCTGAACATAGCTCTATAACAATGATTGTCAAACTTTTCTAACTGGAGCTCAGAGTAAGA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_017881.2
• Summary: Nicotinamide adenine dinucleotide (NAD+) is essential for life in all organisms, both as a coenzyme for oxidoreductases and as a source of ADP-ribosyl groups used in various reactions. Nicotinic acid and nicotinamide, collectively known as niacin, are the vitamin precursors of NAD+. Nicotinamide riboside kinases, such as NRK1, function to synthesize NAD+ through nicotinamide mononucleotide using nicotinamide riboside as the precursor (Bieganowski and Brenner, 2004 [PubMed 15137942]). [supplied by OMIM, Mar 2008]
• Locus ID: 54981