RASGRF2 (NM_006909) Human 3' UTR Clone

CAT#: SC204901

3`UTR clone of Ras protein-specific guanine nucleotide-releasing factor 2 (RASGRF2) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: RASGRF2
• Synonyms: GRF2; RAS-GRF2
• ACCN: NM_006909
• Insert Size: 372 bp
• Sequence Data:
  Insert Sequence

  >SC204901 3'UTR clone of NM_006909
  The sequence shown below is from the reference sequence of NM_006909. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TTGAACCTCGACTCCCTGCTTGAAGATCTGGCCTTGCCCCTGAGTCCACGGGATGTTCATGGAAAGCAGG
  ACAGACAGAATTGTGTATGCCTTGCCTATCACGGTACAGCACGAAGCCAGGCTCCTTTCTCCACCAAAGA
  AGATGGAACCAGACTGGAATTCTGTCTCCAGAGAGAAACCCAGCTGTTTGGGTCAAAGACAGATGCTTCA
  GACTTGGGTGGGAAGGTGAAAGATGGCTATTTAGAAAGCTGGTGGCACGTTTTACATAAGGGAATGTCAG
  ATGGGAGATGCTAGTTGCCATTTTAACAAAGCAGGTAAATCGGTAAATTTTAAACTCTGTCCATGTTCTG
  TTAGAACTCAGGGACAAGGATC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_006909.1
• Summary: 'RAS GTPases cycle between an inactive GDP-bound state and an active GTP-bound state. This gene encodes a calcium-regulated nucleotide exchange factor activating both RAS and RAS-related protein, RAC1, through the exchange of bound GDP for GTP, thereby, coordinating the signaling of distinct mitogen-activated protein kinase pathways. [provided by RefSeq, Oct 2011]'
• Locus ID: 5924