Ornithine Carbamoyltransferase (OTC) (NM_000531) Human 3' UTR Clone

CAT#: SC204954

3`UTR clone of ornithine carbamoyltransferase (OTC) nuclear gene encoding mitochondrial protein for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: OTC
• Synonyms: OCTD
• ACCN: NM_000531
• Insert Size: 390 bp
• Sequence Data:
  Insert Sequence

  >SC204954 3'UTR clone of NM_000531
  The sequence shown below is from the reference sequence of NM_000531. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GCTGACAGATTACTCACCTCAGCTCCAGAAGCCTAAATTTTGATGTTGTGTTACTTGTCAAGAAAGAAGC
  AATGTTCTTCAGTAACAGAATGAGTTGGTTTATGGGGAAAAGAGAAGAGAATCTAAAAAATAAACAAATC
  CCTAACACGTGGTATGGGTGAACCGTATGATATGCTTTGCCATTGTGAAACTTTCCTTAAGCCTTTAATT
  TAAGTGCTGATGCACTGTAATACGTGCTTAACTTTGCTTAAACTCTCTAATTCCCAATTTCTGAGTTACA
  TTTAGATATCATATTAATTATCATATACATTTACTTCAACATAAAATACTGTGTTCATAATGTATAATGT
  CTAAGCCATTAAGTGTAATCTATGCTTATTACCTAAATAA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_000531.5
• Summary: 'This nuclear gene encodes a mitochondrial matrix enzyme. Missense, nonsense, and frameshift mutations in this enzyme lead to ornithine transcarbamylase deficiency, which causes hyperammonemia. Since the gene for this enzyme maps close to that for Duchenne muscular dystrophy, it may play a role in that disease also. [provided by RefSeq, Jul 2008]'
• Locus ID: 5009