Ornithine Carbamoyltransferase (OTC) (NM_000531) Human 3' UTR Clone

CAT#: SC204954

3`UTR clone of ornithine carbamoyltransferase (OTC) nuclear gene encoding mitochondrial protein for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol OTC
Synonyms OCTD
ACCN NM_000531
Insert Size 390 bp
Sequence Data
>SC204954 3'UTR clone of NM_000531
The sequence shown below is from the reference sequence of NM_000531. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GCTGACAGATTACTCACCTCAGCTCCAGAAGCCTAAATTTTGATGTTGTGTTACTTGTCAAGAAAGAAGC
AATGTTCTTCAGTAACAGAATGAGTTGGTTTATGGGGAAAAGAGAAGAGAATCTAAAAAATAAACAAATC
CCTAACACGTGGTATGGGTGAACCGTATGATATGCTTTGCCATTGTGAAACTTTCCTTAAGCCTTTAATT
TAAGTGCTGATGCACTGTAATACGTGCTTAACTTTGCTTAAACTCTCTAATTCCCAATTTCTGAGTTACA
TTTAGATATCATATTAATTATCATATACATTTACTTCAACATAAAATACTGTGTTCATAATGTATAATGT
CTAAGCCATTAAGTGTAATCTATGCTTATTACCTAAATAA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_000531.5
Summary 'This nuclear gene encodes a mitochondrial matrix enzyme. Missense, nonsense, and frameshift mutations in this enzyme lead to ornithine transcarbamylase deficiency, which causes hyperammonemia. Since the gene for this enzyme maps close to that for Duchenne muscular dystrophy, it may play a role in that disease also. [provided by RefSeq, Jul 2008]'
Locus ID 5009

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.