Superoxide Dismutase 1 (SOD1) (NM_000454) Human 3' UTR Clone

CAT#: SC204961

3`UTR clone of superoxide dismutase 1 soluble (SOD1) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: SOD1
• Synonyms: ALS; ALS1; HEL-S-44; homodimer; hSod1; IPOA; SOD; STAHP
• ACCN: NM_000454
• Insert Size: 370 bp
• Sequence Data:
  Insert Sequence

  >SC204961 3'UTR clone of NM_000454
  The sequence shown below is from the reference sequence of NM_000454. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GGAAGTCGTTTGGCTTGTGGTGTAATTGGGATCGCCCAATAAACATTCCCTTGGATGTAGTCTGAGGCCC
  CTTAACTCATCTGTTATCCTGCTAGCTGTAGAAATGTATCCTGATAAACATTAAACACTGTAATCTTAAA
  AGTGTAATTGTGTGACTTTTTCAGAGTTGCTTTAAAGTACCTGTAGTGAGAAACTGATTTATGATCACTT
  GGAAGATTTGTATAGTTTTATAAAACTCAGTTAAAATGTCTGTTTCAATGACCTGTATTTTGCCAGACTT
  AAATCACAGATGGGTATTAAACTTGTCAGAATTTCTTTGTCATTCAAGCCTGTGAATAAAAACCCTGTAT
  GGCACTTATTATGAGGCTAT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_000454.4
• Summary: 'The protein encoded by this gene binds copper and zinc ions and is one of two isozymes responsible for destroying free superoxide radicals in the body. The encoded isozyme is a soluble cytoplasmic protein, acting as a homodimer to convert naturally-occuring but harmful superoxide radicals to molecular oxygen and hydrogen peroxide. The other isozyme is a mitochondrial protein. In addition, this protein contains an antimicrobial peptide that displays antibacterial, antifungal, and anti-MRSA activity against E. coli, E. faecalis, S. aureus, S. aureus MRSA LPV+, S. agalactiae, and yeast C. krusei. Mutations in this gene have been implicated as causes of familial amyotrophic lateral sclerosis. Rare transcript variants have been reported for this gene. [provided by RefSeq, Jul 2020]'
• Locus ID: 6647