DYRK1B (NM_006483) Human 3' UTR Clone

CAT#: SC204976

3`UTR clone of dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1B (DYRK1B) transcript variant b for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "DYRK1B"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol DYRK1B
Synonyms AOMS3; MIRK
ACCN NM_006483
Insert Size 357
Sequence Data
>SC204976 3'UTR clone of NM_006483
The sequence shown below is from the reference sequence of NM_006483. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

AGCAGCCAGCTCGTGACCCTGCCCCCTCCCTGGGGCCCCTCCTGAAGCCATACCCTCCCCCATCTGGGGG
CCCTGGGCTCCCATCCTCATCTCTCTCCTTGACTGGAATTGCTGCTACCCAGCTGGGGTGGGTGAGGCCT
GCACTGATTGGGGCCTGGGGCAGGGGGGTCAAGGAGAGGGTTTTGGCCGCTCCCTCCCCACTAAGGACTG
GACCCTTGGGCCCCTCTCCCCCTTTTTTTCTATTTATTGTACCAAAGACAGTGGTGGTCCGGTGGAGGGA
AGACCCCCCCTCACCCCAGGACCCTAGGAGGGGGTGGGGGCAGGTAGGGGGAGATGGCCTTGCTCCTCCT
CGCTGTA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_006483.1
Summary This gene encodes a member of a family of nuclear-localized protein kinases. The encoded protein participates in the regulation of the cell cycle. Expression of this gene may be altered in tumor cells, and mutations in this gene were found to cause abdominal obesity-metabolic syndrome 3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]
Locus ID 9149

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.