TdT (DNTT) (NM_004088) Human 3' UTR Clone

CAT#: SC204987

3`UTR clone of deoxynucleotidyltransferase terminal (DNTT) transcript variant 1 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "DNTT"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol DNTT
Synonyms TDT
ACCN NM_004088
Insert Size 338 bp
Sequence Data
>SC204987 3'UTR clone of NM_004088
The sequence shown below is from the reference sequence of NM_004088. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GTGGGAAAGAAATGCCTAGGAAAGTGTTGTCAACATTTTTTTCCTATTCTTTTCAAGTTAAATAAATTAT
GCTTCATATTAGTAAAAGATGCCATAGGAGAGTTTGGGGTTATTTAGGTCTTATTGAAATGCAGATTGCT
ACTAGAAATAAATAACTTTGGAAACATGGGAAGGTGCCACTGGTAATGGGTAAGGTTCTAATAGGCCATG
TTTATGACTGTTGCATAGAATTCACAATGCATTTTTCAAGAGAAATGATGTTGTCACTGGTGGCTCATTC
AGGGAAGCTCATCAAAGCCCACTTTGTTCGCAGTGTAGCTGAAATACTGTCTATCTCT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_004088.3
Summary 'This gene is a member of the DNA polymerase type-X family and encodes a template-independent DNA polymerase that catalyzes the addition of deoxynucleotides to the 3'-hydroxyl terminus of oligonucleotide primers. In vivo, the encoded protein is expressed in a restricted population of normal and malignant pre-B and pre-T lymphocytes during early differentiation, where it generates antigen receptor diversity by synthesizing non-germ line elements (N-regions) at the junctions of rearranged Ig heavy chain and T cell receptor gene segments. Alternatively spliced transcript variants encoding different isoforms of this gene have been described. [provided by RefSeq, Jul 2008]'
Locus ID 1791

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.