Claudin 14 (CLDN14) (NM_144492) Human 3' UTR Clone

CAT#: SC204989

3`UTR clone of claudin 14 (CLDN14) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CLDN14
• Synonyms: DFNB29
• ACCN: NM_144492
• Insert Size: 373
• Sequence Data:
  Insert Sequence

  >SC204989 3'UTR clone of NM_144492
  The sequence shown below is from the reference sequence of NM_144492. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TACAGGCTGAACGACTACGTGTGAGTCCCCACAGCCTGCTTCTCCCCTGGGCTGCTGTGGGCTGGGTCCC
  CGGCGGGACTGTCAATGGAGGCAGGGGTTCCAGCACAAAGTTTACTTCTGGGCAATTTTTGTATCCAAGG
  AAATAATGTGAATGCGAGGAAATGTCTTTAGAGCACAGGGACAGAGGGGGAAATAAGAGGAGGAGAAAGC
  TCTCTATACCAAAGACTGAAAAAAAAAATCCTGTCTGTTTTTGTATTTATTATATATATTTATGTGGGTG
  ATTTGATAACAAGTTTAATATAAAGTGACTTGGGAGTTTGGTCAGTGGGGTTGGTTTGTGATCCAGGAAT
  AAACCTTGCGGATGTGGCTGTTT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_144492.2
• Summary: Tight junctions represent one mode of cell-to-cell adhesion in epithelial or endothelial cell sheets, forming continuous seals around cells and serving as a physical barrier to prevent solutes and water from passing freely through the paracellular space. These junctions are comprised of sets of continuous networking strands in the outwardly facing cytoplasmic leaflet, with complementary grooves in the inwardly facing extracytoplasmic leaflet. The protein encoded by this gene, a member of the claudin family, is an integral membrane protein and a component of tight junction strands. The encoded protein also binds specifically to the WW domain of Yes-associated protein. Defects in this gene are the cause of an autosomal recessive form of nonsyndromic sensorineural deafness. It is also reported that four synonymous variants in this gene are associated with kidney stones and reduced bone mineral density. Several transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jun 2010]
• Locus ID: 23562