PTPLB (HACD2) (NM_198402) Human 3' UTR Clone

CAT#: SC205014

3`UTR clone of protein tyrosine phosphatase-like (proline instead of catalytic arginine) member b (PTPLB) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: HACD2
• Synonyms: PTPLB
• ACCN: NM_198402
• Insert Size: 384
• Sequence Data:
  Insert Sequence

  >SC205014 3'UTR clone of NM_198402
  The sequence shown below is from the reference sequence of NM_198402. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TCTCATACTGAAGAACACAAGAAATTTGAATAGTTCCTGCTTTCTGCACCTCCCACCAAAACAAACTTTT
  CAATGATCAAAAAATGCTGCAGATTTTTTGAGTTCCCAATACGTTTCATAGAAAATAAGTAAGAACTATT
  TTTAAAATATTCAAACAAAACTAAAACAAAAATCCAGTGTCACATGGGCCTGAGATTTTATTTTAGAAAA
  AGGTTGTTACATAAAACACCCTGGCCAGTTCATTTCAGCATGCTCTTTCAACCAGAAGTTCTTAATATTT
  ATGATGGCACTAGAAAGGGATTTGGCATTTTATGTCCTTCTGTGTCCTTCATGTATCTGATCAATGAAGA
  CCTGTAACACTAAGTACTTGAGAGTTACAGTCTG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_198402.3
• Summary: The protein encoded by this gene can catalyze the third step (dehydration) in the conversion of long chain fatty acids to very long chain fatty acids. The encoded protein localizes to the endoplasmic reticulum membrane. [provided by RefSeq, Jul 2016]
• Locus ID: 201562