WNT7A (NM_004625) Human 3' UTR Clone

CAT#: SC205065

3`UTR clone of wingless-type MMTV integration site family member 7A (WNT7A) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: WNT7A
• Synonyms: Wnt-7a
• ACCN: NM_004625
• Insert Size: 383 bp
• Sequence Data:
  Insert Sequence

  >SC205065 3'UTR clone of NM_004625
  The sequence shown below is from the reference sequence of NM_004625. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  ACGGAGATGTACACGTGCAAGTGAGCCCCGTGTGCACACCACCCTCCCGCTGCAAGTCAGATTGCTGGGA
  GGACTGGACCGTTTCCAAGCTGCGGGCTCCCTGGCAGGATGCTGAGCTTGTCTTTTCTGCTGAGGAGGGT
  ACTTTTCCTGGGTTTCCTGCAGGCATCCGTGGGGGAAAAAAAATCTCTCAGAGCCCTCAACTATTCTGTT
  CCACACCCAATGCTGCTCCACCCTCCCCCAGACACAGCCCAGGTCCCTCCGCGGCTGGAGCGAAGCCTTC
  TGCAGCAGGAACTCTGGACCCCTGGGCCTCATCACAGCAATATTTAACAATTTATTCTGATAAAAATAAT
  ATTAATTTATTTAATTAAAAAGAATTCTTCCAC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_004625.3
• Summary: 'This gene is a member of the WNT gene family, which consists of structurally related genes that encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene is involved in the development of the anterior-posterior axis in the female reproductive tract, and also plays a critical role in uterine smooth muscle pattering and maintenance of adult uterine function. Mutations in this gene are associated with Fuhrmann and Al-Awadi/Raas-Rothschild/Schinzel phocomelia syndromes. [provided by RefSeq, Jul 2008]'
• Locus ID: 7476