ASTN2 (NM_198188) Human 3' UTR Clone

CAT#: SC205071

3`UTR clone of astrotactin 2 (ASTN2) transcript variant 4 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ASTN2
• Synonyms: bA67K19.1
• ACCN: NM_198188
• Insert Size: 371
• Sequence Data:
  Insert Sequence

  >SC205071 3'UTR clone of NM_198188
  The sequence shown below is from the reference sequence of NM_198188. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GACTCTATCAAAAGTCTCTCCTTTTTAAACCTTTTCTTATGGATGGCTGTCAATCCCGAGGCAGAAGTTT
  TCAGGTGGAGACCAAGCGGCCTTTGCTCTTCTTCCTTCTTCCTGCCACACTCTGCTTTCTTCCTGCCATG
  GACCCCTGGAGGAGACCTATGGAGGGACAGTTTTGACCTGACCCCTAGAGGAGACAGTTTTGACCTCTTC
  AGCACCAGGAAGGAAGCTCTGAGGATGGTTGCAGTGAGGAAGCATGGGTCTTTAAGGACTTCTCTCTCTT
  TTTTGCTGGACATTATTGAGTTTGTGGGACCCTGCCTCTTCCTGCTACCTGTGGGTCTGCCCAGAGTCCC
  TGCAGGCCTGTCCATGCATTA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_198188.1
• Summary: This gene encodes a protein that is expressed in the brain and may function in neuronal migration, based on functional studies of the related astrotactin 1 gene in human and mouse. A deletion at this locus has been associated with schizophrenia. Multiple transcript variants encoding different proteins have been found for this locus. [provided by RefSeq, May 2010]
• Locus ID: 23245