MASP2 (NM_006610) Human 3' UTR Clone

CAT#: SC205081

3`UTR clone of mannan-binding lectin serine peptidase 2 (MASP2) transcript variant 1 for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "MASP2"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol MASP2
Synonyms MAP19; MASP-2; MASP1P1; sMAP
ACCN NM_006610
Insert Size 378
Sequence Data
>SC205081 3'UTR clone of NM_006610
The sequence shown below is from the reference sequence of NM_006610. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CTATATTCCCTGGATCGAGAACATAATTAGTGATTTTTAACTTGCGTGTCTGCAGTCAAGGATTCTTCAT
TTTTAGAAATGCCTGTGAAGACCTTGGCAGCGACGTGGCTCGAGAAGCATTCATCATTACTGTGGACATG
GCAGTTGTTGCTCCACCCAAAAAAACAGACTCCAGGTGAGGCTGCTGTCATTTCTCCACTTGCCAGTTTA
ATTCCAGCCTTACCCATTGACTCAAGGGGACATAAACCACGAGAGTGACAGTCATCTTTGCCCACCCAGT
GTAATGTCACTGCTCAAATTACATTTCATTACCTTAAAAAGCCAGTCTCTTTTCATACTGGCTGTTGGCA
TTTCTGTAAACTGCCTGTCCATGCTCTT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_006610.2
Summary This gene encodes a member of the peptidase S1 family of serine proteases. The encoded preproprotein is proteolytically processed to generate A and B chains that heterodimerize to form the mature protease. This protease cleaves complement components C2 and C4 in order to generate C3 convertase in the lectin pathway of the complement system. The encoded protease also plays a role in the coagulation cascade through cleavage of prothrombin to form thrombin. Myocardial infarction and acute stroke patients exhibit reduced serum concentrations of the encoded protein. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. [provided by RefSeq, Feb 2016]
Locus ID 10747

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.