Aconitase 2 (ACO2) (NM_001098) Human 3' UTR Clone

CAT#: SC205095

3`UTR clone of aconitase 2 mitochondrial (ACO2) nuclear gene encoding mitochondrial protein for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ACO2
• Synonyms: ACONM; HEL-S-284; ICRD; OCA8; OPA9
• ACCN: NM_001098
• Insert Size: 406 bp
• Sequence Data:
  Insert Sequence

  >SC205095 3'UTR clone of NM_001098
  The sequence shown below is from the reference sequence of NM_001098. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GCCCTCAACAGAATGAAGGAACTGCAACAGTGAGGGCAGTGCCTCCCCGCCCCGCCGCTGGCGTCAAGTT
  CAGCTCCACGTGTGCCATCAGTGGATCCGATCCGTCCAGCCATGGCTTCCTATTCCAAGATGGTGTGACC
  AGACATGCTTCCTGCTCCCCGCTTAGCCCACGGAGTGACTGTGGTTGTGGTGGGGGGGTTCTTAAAATAA
  CTTTTTAGCCCCCGTCTTCCTATTTTGAGTTTGGTTCAGATCTTAAGCAGCTCCATGCAACTGTATTTAT
  TTTTGATGACAAGACTCCCATCTAAAGTTTTTCTCCTGCCTGATCATTTCATTGGTGGCTGAAGGATTCT
  AGAGAACCTTTTGTTCTTGCAAGGAAAACAAGAATCCAAAACCAGTGACTGTTCTG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001098.2
• Summary: 'The protein encoded by this gene belongs to the aconitase/IPM isomerase family. It is an enzyme that catalyzes the interconversion of citrate to isocitrate via cis-aconitate in the second step of the TCA cycle. This protein is encoded in the nucleus and functions in the mitochondrion. It was found to be one of the mitochondrial matrix proteins that are preferentially degraded by the serine protease 15(PRSS15), also known as Lon protease, after oxidative modification. [provided by RefSeq, Jul 2008]'
• Locus ID: 50