DEF6 (NM_022047) Human 3' UTR Clone

CAT#: SC205180

3`UTR clone of differentially expressed in FDCP 6 homolog (mouse) (DEF6) for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "DEF6"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol DEF6
Synonyms IBP; SLAT; SWAP70L
ACCN NM_022047
Insert Size 371
Sequence Data
>SC205180 3'UTR clone of NM_022047
The sequence shown below is from the reference sequence of NM_022047. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CCCTCAGGAAGATAAACTGGATCCAGCACCAGAAAATTAGCCTCTCTTAGCCCCTTGTTCTTCCCAATGT
CATATCCACCAGGACCTGGCCACAGCTGGCCTGTGGGTGATCCCAGCTCTTACTAGGAGAGGGAGCTGAG
GTCCTGGTGCCAGGGGCCCAGGCCCTCCAACCATAAACAGTCCAGGATGGAACCTGGTTCACCCTTCATA
CCAGCTCCAAGCCCCAGACCATGGGAGCTGTCTGGGATGTTGATCCTTGAGAACTTGGCCCTGTGCTTTA
GACCCAAGGACCCGATTCTTGGGCTAGGAAAGAGAGAACAAGCAAGCCGGGGCTACCTGCCCCCAGGTGG
CCACCAAGTTGTGGAAGCACA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_022047.3
Summary DEF6, or IBP, is a guanine nucleotide exchange factor (GEF) for RAC (MIM 602048) and CDC42 (MIM 116952) that is highly expressed in B and T cells (Gupta et al., 2003 [PubMed 12923183]). [supplied by OMIM, Mar 2008]
Locus ID 50619

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.