Glypican 3 (GPC3) (NM_004484) Human 3' UTR Clone

CAT#: SC205246

3`UTR clone of glypican 3 (GPC3) transcript variant 2 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "GPC3"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol GPC3
Synonyms DGSX; GTR2-2; MXR7; OCI-5; SDYS; SGB; SGBS; SGBS1
ACCN NM_004484
Insert Size 382 bp
Sequence Data
>SC205246 3'UTR clone of NM_004484
The sequence shown below is from the reference sequence of NM_004484. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CATCTCGGTGGTGTGCTTCTTCTTCCTGGTGCACTGACTGCCTGGTGCCCAGCACATGTGCTGCCCTACA
GCACCCTGTGGTCTTCCTCGATAAAGGGAACCACTTTCTTATTTTTTTCTATTTTTTTTTTTTTGTTATC
CTGTATACCTCCTCCAGCCATGAAGTAGAGGACTAACCATGTGTTATGTTTTCGAAAATCAAATGGTATC
TTTTGGAGGAAGATACATTTTAGTGGTAGCATATAGATTGTCCTTTTGCAAAGAAAGAAAAAAAACCATC
AAGTTGTGCCAAATTATTCTCCTATGTTTGGCTGCTAGAACATGGTTACCATGTCTTTCTCTCTCACTCC
CTCCCTTTCTATCGTTCTCTCTTTGCATGGAT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_004484.3
Summary 'Cell surface heparan sulfate proteoglycans are composed of a membrane-associated protein core substituted with a variable number of heparan sulfate chains. Members of the glypican-related integral membrane proteoglycan family (GRIPS) contain a core protein anchored to the cytoplasmic membrane via a glycosyl phosphatidylinositol linkage. These proteins may play a role in the control of cell division and growth regulation. The protein encoded by this gene can bind to and inhibit the dipeptidyl peptidase activity of CD26, and it can induce apoptosis in certain cell types. Deletion mutations in this gene are associated with Simpson-Golabi-Behmel syndrome, also known as Simpson dysmorphia syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]'
Locus ID 2719

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.