RUNX1 (NM_001122607) Human 3' UTR Clone

CAT#: SC205258

3`UTR clone of runt-related transcription factor 1 (RUNX1) transcript variant 3 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: RUNX1
• Synonyms: AML1; AML1-EVI-1; AMLCR1; CBF2alpha; CBFA2; EVI-1; PEBP2aB; PEBP2alpha
• ACCN: NM_001122607
• Insert Size: 430 bp
• Sequence Data:
  Insert Sequence

  >SC205258 3'UTR clone of NM_001122607
  The sequence shown below is from the reference sequence of NM_001122607. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GAGTCAGATGCAGGAGGAAGACACAGCACCCTGGAGATGTTAAGGCAGAAGTCAGTTCTTCTGTCCATCC
  CTCTCCCCAGCCAGGATAGAGCTATCTTTTCCATCTCATCCTCAGAAGAGACTCAGAAGAAAGATGACAG
  CCCTCAGAATGCACGTTATGAGGAAGGCAGAATGTGGGTCTGTAATTCCTCCGTGTCCCTTCTCCCCCTC
  TGCAAACCGTCGTAACAATAATAGTTCCTAACACATGGGACAATTGTGAGGATTAAATGAGTTAGCCTGC
  AGAAATCACTTGATGCACAGCACATGGGAAGCATTGTGTGTATTTATTAATCCTTCACAAAGTCTTTGAG
  ATATATTTTTATCAAATATTTAGCATGGATCCCGGTACACTTTCAATACTTAATAAATGGTCAATGTTAT
  TCTTTTTCAC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001122607.1
• Summary: 'Core binding factor (CBF) is a heterodimeric transcription factor that binds to the core element of many enhancers and promoters. The protein encoded by this gene represents the alpha subunit of CBF and is thought to be involved in the development of normal hematopoiesis. Chromosomal translocations involving this gene are well-documented and have been associated with several types of leukemia. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]'
• Locus ID: 861