AKR1B1 (NM_001628) Human 3' UTR Clone

CAT#: SC205264

3`UTR clone of aldo-keto reductase family 1 member B1 (aldose reductase) (AKR1B1) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: AKR1B1
• Synonyms: ADR; ALDR1; ALR2; AR
• ACCN: NM_001628
• Insert Size: 399 bp
• Sequence Data:
  Insert Sequence

  >SC205264 3'UTR clone of NM_001628
  The sequence shown below is from the reference sequence of NM_001628. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TGAGCTGTACCTCCCACAAGGATTACCCCTTCCATGAAGAGTTTTGAAGCTGTGGTTGCCTGCTCGTCCC
  CAAGTGACCTATACCTGTGTTTCTTGCCTCATTTTTTTCCTTGCAAATGTAGTATGGCCTGTGTCACTCA
  GCAGTGGGACAGCAACCTGTAGAGTGGCCAGCGAGGGCGTGTCTAGCTTGATGTTGGATCTCAAGAGCCC
  TGTCAGTAGAGTAGAAGTCTCTTCCAGTTTGCTTTGCCCTTCTTTCTACCCTGCTGGGGAAAGTACAACC
  TGAATACCCTTTTCTGACCAAAGAGAAGCAAAATCTACCAGGTCAAAATAGTGCCACTAACGGTTGAGTT
  TTGACTGCTTGGAACTGGAATCCTTTCAGCAAGACTTCTCTTTGCCTCA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001628.2
• Summary: 'This gene encodes a member of the aldo/keto reductase superfamily, which consists of more than 40 known enzymes and proteins. This member catalyzes the reduction of a number of aldehydes, including the aldehyde form of glucose, and is thereby implicated in the development of diabetic complications by catalyzing the reduction of glucose to sorbitol. Multiple pseudogenes have been identified for this gene. The nomenclature system used by the HUGO Gene Nomenclature Committee to define human aldo-keto reductase family members is known to differ from that used by the Mouse Genome Informatics database. [provided by RefSeq, Feb 2009]'
• Locus ID: 231