SFRS9 (SRSF9) (NM_003769) Human 3' UTR Clone

CAT#: SC205274

3`UTR clone of splicing factor arginine/serine-rich 9 (SFRS9) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: SRSF9
• Synonyms: SFRS9; SRp30c
• ACCN: NM_003769
• Insert Size: 347
• Sequence Data:
  Insert Sequence

  >SC205274 3'UTR clone of NM_003769
  The sequence shown below is from the reference sequence of NM_003769. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CTACTTCTCTCCTTTCAGGCCCTACTGAGACAGGTGATGGGAATTTTTTCTTTATTTTTTAGGTTAACTG
  AGCTGCTTTGTGCTCAGAATCTACATTCCAGATTGAGGATTTAGTGTCTTAGGAAATTTTTTTAATTTTT
  TTTTTTTAAAGAAGAAAAAAAACTACATAATTTCTACCAGGGCCATATTAGCAGTGAAACATTTTAAACT
  GCAGAAATTGTGGTTTTGGTTCAGAAACAAGTTGTATATTTTTCACCCCTGATTATGGGAAAAAAATCAG
  TTCTGTCTTTGTGGGTTGCTCTACTATGGAGATCAACAGTTACTGTGACTGAGTCGGCCCATTCTGT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_003769.2
• Summary: The protein encoded by this gene is a member of the serine/arginine (SR)-rich family of pre-mRNA splicing factors, which constitute part of the spliceosome. Each of these factors contains an RNA recognition motif (RRM) for binding RNA and an RS domain for binding other proteins. The RS domain is rich in serine and arginine residues and facilitates interaction between different SR splicing factors. In addition to being critical for mRNA splicing, the SR proteins have also been shown to be involved in mRNA export from the nucleus and in translation. Two pseudogenes, one on chromosome 15 and the other on chromosome 21, have been found for this gene. [provided by RefSeq, Sep 2010]
• Locus ID: 8683