XTP4 (MIEN1) (NM_032339) Human 3' UTR Clone

CAT#: SC205280

3`UTR clone of chromosome 17 open reading frame 37 (C17orf37) for miRNA target validation


Reconstitution Protocol

USD 560.00

5 Days*

Size
    • 10 ug

Product Images

Other products for "MIEN1"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol MIEN1
Synonyms C17orf37; C35; ORB3; RDX12; XTP4
ACCN NM_032339
Insert Size 389
Sequence Data
>SC205280 3'UTR clone of NM_032339
The sequence shown below is from the reference sequence of NM_032339. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

ATCACCAACAGCCGTCCTCCCTGCGTCATCCTGTGACTGCACAGGACTCTGGGTTCCTGCTCTGTTCTGG
GGTCCAAACCTTGGTCTCCCTTTGGTCCTGCTGGGAGCTCCCCCTGCCTCTTTCCCCTACTTAGCTCCTT
AGCAAAGAGACCCTGGCCTCCACTTTGCCCTTTGGGTACAAAGAAGGAATAGAAGATTCCGTGGCCTTGG
GGGCAGGAGAGAGACACTCTCCATGAACACTTCTCCAGCCACCTCATACCCCCTTCCCAGGGTAAGTGCC
CACGAAAGCCCAGTCCACTCTTCGCCTCGGTAATACCTGTCTGATGCCACAGATTTTATTTATTCTCCCC
TAACCCAGGGCAATGTCAGCTATTGGCAGTAAAGTGGCG

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_032339.3
Summary Increases cell migration by inducing filopodia formation at the leading edge of migrating cells. Plays a role in regulation of apoptosis, possibly through control of CASP3. May be involved in a redox-related process. [UniProtKB/Swiss-Prot Function]
Locus ID 84299

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.