PIK3C2G (NM_004570) Human 3' UTR Clone

CAT#: SC205292

3`UTR clone of phosphoinositide-3-kinase class 2 gamma polypeptide (PIK3C2G) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: PIK3C2G
• Synonyms: PI3K-C2-gamma; PI3K-C2GAMMA
• ACCN: NM_004570
• Insert Size: 408 bp
• Sequence Data:
  Insert Sequence

  >SC205292 3'UTR clone of NM_004570
  The sequence shown below is from the reference sequence of NM_004570. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  ATGGTATCCATTAGGAAACAGTATAATTTGACCATTGCTATGAACATATGCATTATTCATTAACTACTTG
  TATTTTTTTCACTTCTGGGCCTCTGAATCACATAAGTAAGGCATCTTTGTTGTCAAAGACAGCACAGGGT
  ATTAAGGACACAGAAAAAAAATCAGAATTAGTCTTTTGTGTTGTTTATTTTCTACCTGTGCTTTCATTGT
  TTTTTCATAATCTTTTCTCCTTCAGTGGAGTACTGATTGCATGAAATTTGATGTGTAAAATAATAAAAGA
  CCTTTATTAAATCATTTTAATATATTTTAAATTAAACATAGGTTTACATTTGTTTTAATTGTGTGCCTAC
  AGTTAAAAGCAGTATTTTTAATGTATTTTATAAGAAAGACAATCAAATAAACCTCATC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_004570.4
• Summary: 'The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling pathways involved in cell proliferation, oncogenic transformation, cell survival, cell migration, and intracellular protein trafficking. This protein contains a lipid kinase catalytic domain as well as a C-terminal C2 domain, a characteristic of class II PI3-kinases. C2 domains act as calcium-dependent phospholipid binding motifs that mediate translocation of proteins to membranes, and may also mediate protein-protein interactions. This gene may play a role in several diseases, including type II diabetes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]'
• Locus ID: 5288