IDH3G (NM_174869) Human 3' UTR Clone

CAT#: SC205295

3`UTR clone of isocitrate dehydrogenase 3 (NAD+) gamma (IDH3G) nuclear gene encoding mitochondrial protein transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: IDH3G
• Synonyms: H-IDHG
• ACCN: NM_174869
• Insert Size: 380 bp
• Sequence Data:
  Insert Sequence

  >SC205295 3'UTR clone of NM_174869
  The sequence shown below is from the reference sequence of NM_174869. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CCTGCAGCCTCCTGTAGCCCGCCTCATGCACTGACCACAGCCCCCAGGGGAGGATGGTACTGGATCTGGC
  CCCATCTTCTGGCCCTTAGCTGGTGCCACTTCCCTCCTGTGGCAATCCCAGTCCTGCACGTCACAGGAGA
  CAGCGGGGGGTGGCAGGGCCTGGTGTGTGCCGAGCCTGCCTGTGTCCTACAGATGCACACTCCGGACATC
  GGGGGCCAGGGCACAACATCTGAAGCCATCCAGGACGTCATCCGCCACATCCGCGTCATCAACGGCCGGG
  CCGTGGAGGCCTAGGCTGGCCCTAGGACCTTCTTGGTTTGCTCCTTGGATTCCCCTTCCCACTCCAGCAC
  CCCAGCCAGCCTGGTACGCAGATCCCAGAA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_174869.1
• Summary: 'Isocitrate dehydrogenases catalyze the oxidative decarboxylation of isocitrate to 2-oxoglutarate. These enzymes belong to two distinct subclasses, one of which utilizes NAD(+) as the electron acceptor and the other NADP(+). Five isocitrate dehydrogenases have been reported: three NAD(+)-dependent isocitrate dehydrogenases, which localize to the mitochondrial matrix, and two NADP(+)-dependent isocitrate dehydrogenases, one of which is mitochondrial and the other predominantly cytosolic. NAD(+)-dependent isocitrate dehydrogenases catalyze the allosterically regulated rate-limiting step of the tricarboxylic acid cycle. Each isozyme is a heterotetramer that is composed of two alpha subunits, one beta subunit, and one gamma subunit. The protein encoded by this gene is the gamma subunit of one isozyme of NAD(+)-dependent isocitrate dehydrogenase. This gene is a candidate gene for periventricular heterotopia. Several alternatively spliced transcript variants of this gene have been described, but only some of their full length natures have been determined. [provided by RefSeq, Jul 2008]'
• Locus ID: 3421