LILRB5 (NM_001081443) Human 3' UTR Clone

CAT#: SC205304

3`UTR clone of leukocyte immunoglobulin-like receptor subfamily B (with TM and ITIM domains) member 5 (LILRB5) transcript variant 3 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: LILRB5
• Synonyms: CD85C; LIR-8; LIR8
• ACCN: NM_001081443
• Insert Size: 410
• Sequence Data:
  Insert Sequence

  >SC205304 3'UTR clone of NM_001081443
  The sequence shown below is from the reference sequence of NM_001081443. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GCTGAACCCAGCATCTACGCCCCCCTGGCCATCCACTAGCCCACGGGGGACCCAGATCTCATACTCAACA
  GAAGGAGACTCAGAGACTCCAGAAGGCACAGGAGCTGCCCCCAGTGGACACCAATGAACCCCAGCCAGCC
  TGGACCCCTAACAAAGACCACCAGGACATCCTGGGAACTCTGGGACTCACTAGATTCTGCAGTCAAAGAT
  GACTAATATCCTTGCATTTTTGAAATGAAGCCACAGACTTCTCAATAAATCAATGAGCTGAGAAAACTGA
  AACAGAAATTAGAGCATGGTATAAATTTGGAATGATAATGTAAATATTACACATTAAATGATGAAATCGG
  AAAACTACAAATGAGCGAATGAATTAGAAAAGAATAAAACCTACGTAATTAATGACCTTG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_001081443.1
• Summary: This gene is a member of the leukocyte immunoglobulin-like receptor (LIR) family, which is found in a gene cluster at chromosomal region 19q13.4. The encoded protein belongs to the subfamily B class of LIR receptors which contain two or four extracellular immunoglobulin domains, a transmembrane domain, and two to four cytoplasmic immunoreceptor tyrosine-based inhibitory motifs (ITIMs). Several other LIR subfamily B receptors are expressed on immune cells where they bind to MHC class I molecules on antigen-presenting cells and inhibit stimulation of an immune response. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
• Locus ID: 10990