Adipose Triglyceride Lipase (PNPLA2) (NM_020376) Human 3' UTR Clone

CAT#: SC205323

3`UTR clone of patatin-like phospholipase domain containing 2 (PNPLA2) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: PNPLA2
• Synonyms: 1110001C14Rik; ATGL; FP17548; iPLA2zeta; PEDF-R; TTS-2.2; TTS2
• ACCN: NM_020376
• Insert Size: 383
• Sequence Data:
  Insert Sequence

  >SC205323 3'UTR clone of NM_020376
  The sequence shown below is from the reference sequence of NM_020376. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CCCCTGCTCCCGAGGCCCGGCCCGTGATCGGGGCCCTGGGGCTGTGAGACCCCGACCCTCTCGAGGAACC
  CTGCCTGAGACGCCTCCATTACCACTGCGCAGTGAGATGAGGGGACTCACAGTTGCCAAGAGGGGTCTTT
  GCCGTGGGCCCCCTCGCCAGCCACTCACCAGCTGCATGCACTGAGAGGGGAGGTTTCCACACCCCTCCCC
  TGGGCCGCTGAGGCCCCGCGCACCTGTGCCTTAATCTTCCCTCCCCTGTGCTGCCCGAGCACCTCCCCCG
  CCCCTTTACTCCTGAGAACTTTGCAGCTGCCCTTCCCTCCCCGTTTTTCATGGCCTGCTGAAATATGTGT
  GTGAAGAATTATTTATTTTCGCCAAAGCACATG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_020376.2
• Summary: This gene encodes an enzyme which catalyzes the first step in the hydrolysis of triglycerides in adipose tissue. Mutations in this gene are associated with neutral lipid storage disease with myopathy. [provided by RefSeq, Jul 2010]
• Locus ID: 57104