FMO3 (NM_006894) Human 3' UTR Clone

CAT#: SC205333

3`UTR clone of flavin containing monooxygenase 3 (FMO3) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: FMO3
• Synonyms: dJ127D3.1; FMOII; TMAU
• ACCN: NM_006894
• Insert Size: 398 bp
• Sequence Data:
  Insert Sequence

  >SC205333 3'UTR clone of NM_006894
  The sequence shown below is from the reference sequence of NM_006894. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TCGCTGTTTTCCTTGTGTTGACCTAATCATCATTTTCTCTAGGATTTCTGAAAGTTACTGACAATACCCA
  GACAGGGGCTTTGCTATTTAAAAATTAAAATTTTCACACCACCTGCTTTTCTATTCAGCATCTTTTGCAG
  TACTCTGTAGACATTAGTCAGTAATACAGTGTTATTTCTAGGCTCTGAAATAGCCACTTTAAGAATCATG
  TCATGATCTTAAGAGAGCACTAATCATTTCTGTTTGAGTTCCACTAACACTTCAAAATCAGAACTATGTT
  CTTTATATCTAACTTAAATCATTTCCTGAAACATTTTGACATGATTCCTTTTTCCTTTTAAACAATGTAT
  GAAAGATGTATTTTAAATCTAAATAAAGAGCAAATTAAGCAGAATAAT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_006894.5
• Summary: 'Flavin-containing monooxygenases (FMO) are an important class of drug-metabolizing enzymes that catalyze the NADPH-dependent oxygenation of various nitrogen-,sulfur-, and phosphorous-containing xenobiotics such as therapeutic drugs, dietary compounds, pesticides, and other foreign compounds. The human FMO gene family is composed of 5 genes and multiple pseudogenes. FMO members have distinct developmental- and tissue-specific expression patterns. The expression of this FMO3 gene, the major FMO expressed in adult liver, can vary up to 20-fold between individuals. This inter-individual variation in FMO3 expression levels is likely to have significant effects on the rate at which xenobiotics are metabolised and, therefore, is of considerable interest to the pharmaceutical industry. This transmembrane protein localizes to the endoplasmic reticulum of many tissues. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. Mutations in this gene cause the disorder trimethylaminuria (TMAu) which is characterized by the accumulation and excretion of unmetabolized trimethylamine and a distinctive body odor. In healthy individuals, trimethylamine is primarily converted to the non odorous trimethylamine N-oxide.[provided by RefSeq, Jan 2016]'
• Locus ID: 2328