EPM2A (NM_001018041) Human 3' UTR Clone

CAT#: SC205379

3`UTR clone of epilepsy progressive myoclonus type 2A Lafora disease (laforin) (EPM2A) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: EPM2A
• Synonyms: EPM2; MELF
• ACCN: NM_001018041
• Insert Size: 414
• Sequence Data:
  Insert Sequence

  >SC205379 3'UTR clone of NM_001018041
  The sequence shown below is from the reference sequence of NM_001018041. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  ACATTGACGAAGAGGCAGCTAGCCAGGACACATTTCCACTATAATTTTACAAAGTTAAATTTATAAGCTA
  GCATTAAGTAAAGTGAAGTCCAGCTCCCTTGCTAAAAATAACTAGAGGTAATAATTGGTATTCAGGTAAC
  TCATTTACAGTCATAATGTGTTGTGAAAATTTAATCTTAAAAATTAAATTTTTAAACTATGTGGGTCTGT
  GAATTTCTTTAATGTCTAAGAAATCCAGCTTCATAATTTCCATGATACAAAGATCTTTTTTCAGGTGGAT
  TTTTACCTTTGTTCCTTTTGCTCTGATAGACAAAATCAGTTTAGGACTATTAAAGAATGTTTTGGAATAA
  ACTGTCTTTTTCCTCAATGAATGGGATGTCTAATGTATTTCAAAATCACCCAAAACTTTTGGCA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_001018041.1
• Summary: This gene encodes a dual-specificity phosphatase and may be involved in the regulation of glycogen metabolism. The protein acts on complex carbohydrates to prevent glycogen hyperphosphorylation, thus avoiding the formation of insoluble aggregates. Loss-of-function mutations in this gene have been associated with Lafora disease, a rare, adult-onset recessive neurodegenerative disease, which results in myoclonus epilepsy and usually results in death several years after the onset of symptoms. The disease is characterized by the accumulation of insoluble particles called Lafora bodies, which are derived from glycogen. [provided by RefSeq, Jan 2018]
• Locus ID: 7957