PAPP A2 (PAPPA2) (NM_020318) Human 3' UTR Clone

CAT#: SC205384

3`UTR clone of pappalysin 2 (PAPPA2) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: PAPPA2
• Synonyms: PAPP-A2; PAPP-E; PAPPE; PLAC3
• ACCN: NM_020318
• Insert Size: 378
• Sequence Data:
  Insert Sequence

  >SC205384 3'UTR clone of NM_020318
  The sequence shown below is from the reference sequence of NM_020318. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CCAAGGCAGAAGAAAATCAGTAACTGTGGGAACAAGCCCCTCCCTCCACTGCCTCAGAGGCAGTAAGAAA
  GAGAGGCCGACCCAGGAGGAAACAAAGGGTGAATGAAGAAGAACAATCATGAAATGGAAGAAGGAGGAAG
  AGCATGAAGGATCTTATAAGAAATGCAAGAGGATATTGATAGGTGTGAACTAGTTCATCAAGTAGCCCAA
  GTAGGAGAGAATCATAGGCAAAAGTTTCTTTAAAGTGGCAGTTGATTAACATGGAAGGGGAAATATGATA
  GATATATAAGGACCCTCCTCCCTCACTTATATTCTATTAAATCCTATCCTCAACTCTTGCCCTGCTCTCC
  GCTCCACCCCCTGCCAACTACTCAGTCC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_020318.2
• Summary: This gene encodes a member of the pappalysin family of metzincin metalloproteinases. The encoded protein cleaves insulin-like growth factor-binding protein 5 and is thought to be a local regulator of insulin-like growth factor (IGF) bioavailability. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2010]
• Locus ID: 60676