ECHS1 (NM_004092) Human 3' UTR Clone

CAT#: SC205458

3`UTR clone of enoyl Coenzyme A hydratase short chain1 mitochondrial (ECHS1) nuclear gene encoding mitochondrial protein for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ECHS1
• Synonyms: ECHS1D; SCEH
• ACCN: NM_004092
• Insert Size: 379 bp
• Sequence Data:
  Insert Sequence

  >SC205458 3'UTR clone of NM_004092
  The sequence shown below is from the reference sequence of NM_004092. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GCCAACTTCAAAGACCAGTGAGAACCAGCTGCCCCTGCTTCACACCTCTGCTTGGAGAGGACAAGTGCAG
  CCTGTCAGTTTTAGAAGCAAGTAAATCATCCTCTTTTCAAGAGCAGTGTCCGTGGTGTGCAGTTCCTCTC
  CAATTGCTGCGTGGTCGTGGCCCGACCTCTCACGGCATGACAGCCTTCGTCACCCAGCCTGTGAGGGTCC
  TGACTGGAGCACCTTCTAAATCTAAGATTCTGCTGAGGAGCCCCCGCTGGTCCCTCTGGGCATGCTGTGC
  TCGGACGGAAAGCGGGGCCTGCGGGTCCTTGTGTCCCTGCCGCTGAAGAATGGGGCTGCTCTGAGGGAAA
  CGCTGTCTGCTGCCTTCATACAGATGCTG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_004092.3
• Summary: 'The protein encoded by this gene functions in the second step of the mitochondrial fatty acid beta-oxidation pathway. It catalyzes the hydration of 2-trans-enoyl-coenzyme A (CoA) intermediates to L-3-hydroxyacyl-CoAs. The gene product is a member of the hydratase/isomerase superfamily. It localizes to the mitochondrial matrix. Transcript variants utilizing alternative transcription initiation sites have been described in the literature. [provided by RefSeq, Jul 2008]'
• Locus ID: 1892