KCNH2 (NM_000238) Human 3' UTR Clone

CAT#: SC205467

3`UTR clone of potassium voltage-gated channel subfamily H (eag-related) member 2 (KCNH2) transcript variant 1 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "KCNH2"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol KCNH2
Synonyms ERG-1; ERG1; H-ERG; HERG; HERG1; Kv11.1; LQT2; SQT1
ACCN NM_000238
Insert Size 412 bp
Sequence Data
>SC205467 3'UTR clone of NM_000238
The sequence shown below is from the reference sequence of NM_000238. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CCTGCACAGACACGGCTCGGACCCGGGCAGTTAGTGGGGCTGCCCAGTGTGGACACGTGGCTCACCCAGG
GATCAAGGCGCTGCTGGGCCGCTCCCCTTGGAGGCCCTGCTCAGGAGGCCCTGACCGTGGAAGGGGAGAG
GAACTCGAAAGCACAGCTCCTCCCCCAGCCCTTGGGACCATCTTCTCCTGCAGTCCCCTGGGCCCCAGTG
AGAGGGGCAGGGGCAGGGCCGGCAGTAGGTGGGGCCTGTGGTCCCCCCACTGCCCTGAGGGCATTAGCTG
GTCTAACTGCCCGGAGGCACCCGGCCCTGGGCCTTAGGCACCTCAAGGACTTTTCTGCTATTTACTGCTC
TTATTGTTAAGGATAATAATTAAGGATCATATGAATAATTAATGAAGATGCTGATGACTATG

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_000238.2
Summary 'This gene encodes a voltage-activated potassium channel belonging to the eag family. It shares sequence similarity with the Drosophila ether-a-go-go (eag) gene. Mutations in this gene can cause long QT syndrome type 2 (LQT2). Transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Jul 2008]'
Locus ID 3757

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.