PCBP1 (NM_006196) Human 3' UTR Clone

CAT#: SC205517

3`UTR clone of poly(rC) binding protein 1 (PCBP1) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: PCBP1
• Synonyms: HEL-S-85; hnRNP-E1; hnRNP-X; HNRPE1; HNRPX
• ACCN: NM_006196
• Insert Size: 430 bp
• Sequence Data:
  Insert Sequence

  >SC205517 3'UTR clone of NM_006196
  The sequence shown below is from the reference sequence of NM_006196. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TCAATGCCAGGCTTTCCTCTGAGAAGGGCATGGGGTGCAGCTAGAACAGTGTAGGTTCCCTCAATAACCC
  CTTTCTGCTGTTCTCCCATGATCCAACTGTGTAATTTCTGGTCAGTGATTCCAGGTTTTAAATAATTTGT
  AAGTGTTCAGTTTCTACACAACTTTATCATCCGCTAAGAATTTAAAAATCACATTCTCTGTTCAGCTGTT
  AATGCTGGGATCCATATTTAGTTTTATAAGCTTTTCCCTGTTTTTAGTTTTGTTTTGGGTTTTTTGGCTC
  ATGAATTTTATTTCTGTTTGTCGATAAGAAATGTAAGAGTGGAATGTTAATAAATTTCAGTTTAGTTCTG
  TAATGTCAAGAATTTAAGAATTAAAAAACGGATTGGTTAAAAAATGCTTCATATTTGAAAAAGCTGGGAA
  TTGCTGTCTT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_006196.3
• Summary: 'This intronless gene is thought to have been generated by retrotransposition of a fully processed PCBP-2 mRNA. This gene and PCBP-2 have paralogues (PCBP3 and PCBP4) which are thought to have arisen as a result of duplication events of entire genes. The protein encoded by this gene appears to be multifunctional. It along with PCBP-2 and hnRNPK corresponds to the major cellular poly(rC)-binding protein. It contains three K-homologous (KH) domains which may be involved in RNA binding. This encoded protein together with PCBP-2 also functions as translational coactivators of poliovirus RNA via a sequence-specific interaction with stem-loop IV of the IRES and promote poliovirus RNA replication by binding to its 5'-terminal cloverleaf structure. It has also been implicated in translational control of the 15-lipoxygenase mRNA, human Papillomavirus type 16 L2 mRNA, and hepatitis A virus RNA. The encoded protein is also suggested to play a part in formation of a sequence-specific alpha-globin mRNP complex which is associated with alpha-globin mRNA stability. [provided by RefSeq, Jul 2008]'
• Locus ID: 5093