GRB7 (NM_001030002) Human 3' UTR Clone

CAT#: SC205525

3`UTR clone of growth factor receptor-bound protein 7 (GRB7) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: GRB7
• ACCN: NM_001030002
• Insert Size: 406 bp
• Sequence Data:
  Insert Sequence

  >SC205525 3'UTR clone of NM_001030002
  The sequence shown below is from the reference sequence of NM_001030002. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CGTGCTTGCTGCGCCATTGCTGCACGCGGGTGGCCCTCTGACCAGGCCGTGGACTGGCTCATGCCTCAGC
  CCGCCTTCAGGCTGCCCGCCGCCCCTCCACCCATCCAGTGGACTCTGGGGCGCGGCCACAGGGGACGGGA
  TGAGGAGCGGGAGGGTTCCGCCACTCCAGTTTTCTCCTCTGCTTCTTTGCCTCCCTCAGATAGAAAACAG
  CCCCCACTCCAGTCCACTCCTGACCCCTCTCCTCAAGGGAAGGCCTTGGGTGGCCCCCTCTCCTTCTCCT
  AGCTCTGGAGGTGCTGCTCTAGGGCAGGGAATTATGGGAGAAGTGGGGGCAGCCCAGGCGGTTTCACGCC
  CCACACTTTGTACAGACCGAGAGGCCAGTTGATCTGCTCTGTTTTATACTAGTGAC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001030002.1
• Summary: 'The product of this gene belongs to a small family of adapter proteins that are known to interact with a number of receptor tyrosine kinases and signaling molecules. This gene encodes a growth factor receptor-binding protein that interacts with epidermal growth factor receptor (EGFR) and ephrin receptors. The protein plays a role in the integrin signaling pathway and cell migration by binding with focal adhesion kinase (FAK). Several transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jun 2011]'
• Locus ID: 2886