B MyB (MYBL2) (NM_002466) Human 3' UTR Clone

CAT#: SC205548

3`UTR clone of v-myb myeloblastosis viral oncogene homolog (avian)-like 2 (MYBL2) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: MYBL2
• Synonyms: B-MYB; BMYB
• ACCN: NM_002466
• Insert Size: 396 bp
• Sequence Data:
  Insert Sequence

  >SC205548 3'UTR clone of NM_002466
  The sequence shown below is from the reference sequence of NM_002466. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  ACACATCTCGGACCCTCATCTTGTCCTGAGGTGTTGAGGGTGTCACGAGCCCATTCTCATGTTTACAGGG
  GTTGTGGGGGCAGAGGGGGTCTGTGAATCTGAGAGTCATTCAGGTGACCTCCTGCAGGGAGCCTTCTGCC
  ACCAGCCCCTCCCCAGACTCTCAGGTGGAGGCAACAGGGCCATGTGCTGCCCTGTTGCCGAGCCCAGCTG
  TGGGCGGCTCCTGGTGCTAACAACAAAGTTCCACTTCCAGGTCTGCCTGGTTCCCTCCCCAAGGCCACAG
  GGAGCTCCGTCAGCTTCTCCCAAGCCCACGTCAGGCCTGGCCTCATCTCAGACCCTGCTTAGGATGGGGG
  ATGTGGCCAGGGGTGCTCCTGTGCTCACCCTCTCTTGGTGCATTTT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_002466.2
• Summary: 'The protein encoded by this gene, a member of the MYB family of transcription factor genes, is a nuclear protein involved in cell cycle progression. The encoded protein is phosphorylated by cyclin A/cyclin-dependent kinase 2 during the S-phase of the cell cycle and possesses both activator and repressor activities. It has been shown to activate the cell division cycle 2, cyclin D1, and insulin-like growth factor-binding protein 5 genes. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2013]'
• Locus ID: 4605