NCF4 (NM_013416) Human 3' UTR Clone

CAT#: SC205574

3`UTR clone of neutrophil cytosolic factor 4 40kDa (NCF4) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: NCF4
• Synonyms: CGD3; NCF; P40PHOX; SH3PXD4
• ACCN: NM_013416
• Insert Size: 441 bp
• Sequence Data:
  Insert Sequence

  >SC205574 3'UTR clone of NM_013416
  The sequence shown below is from the reference sequence of NM_013416. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TGGAGGAAGATCTCAGCAGCACTCCCCTATTGAAAGACCTGCTGGAGCTCACAAGGCGGGAGTTCCAGAG
  AGAGGACATAGCTCTGAATTACCGGGACGCTGAGGGGGATCTGGTTCGGCTGCTGTCGGATGAGGACGTA
  GCGCTCATGGTGCGGCAGGCTCGTGGCCTCCCCTCCCAGAAGCGCCTCTTCCCCTGGAAGCTGCACATCA
  CGCAGAAGGACAACTACAGGGTCTACAACACGATGCCATGAGCTGACGGTGTCCCTGGAGCAGTGAGGGG
  ACACCAGCAAAAACCTTCAGCTCTCAGAGGAGATTGGGACCAGGAAAACCTGGGAGGATGGGCAGACTTC
  CTGTCTTTGAGGCTAATGGACCCGTGGGGCTTGTAATCTGTCTCTTTCTACTATTTACATCTGATTTAAA
  TAAACCATTCCATCTGAAAGG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_013416.3
• Summary: 'The protein encoded by this gene is a cytosolic regulatory component of the superoxide-producing phagocyte NADPH-oxidase, a multicomponent enzyme system important for host defense. This protein is preferentially expressed in cells of myeloid lineage. It interacts primarily with neutrophil cytosolic factor 2 (NCF2/p67-phox) to form a complex with neutrophil cytosolic factor 1 (NCF1/p47-phox), which further interacts with the small G protein RAC1 and translocates to the membrane upon cell stimulation. This complex then activates flavocytochrome b, the membrane-integrated catalytic core of the enzyme system. The PX domain of this protein can bind phospholipid products of the PI(3) kinase, which suggests its role in PI(3) kinase-mediated signaling events. The phosphorylation of this protein was found to negatively regulate the enzyme activity. Alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2008]'
• Locus ID: 4689