GPRC5C (NM_022036) Human 3' UTR Clone

CAT#: SC205597

3`UTR clone of G protein-coupled receptor family C group 5 member C (GPRC5C) transcript variant 1 for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "GPRC5C"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol GPRC5C
Synonyms RAIG-3; RAIG3
ACCN NM_022036
Insert Size 420
Sequence Data
>SC205597 3'UTR clone of NM_022036
The sequence shown below is from the reference sequence of NM_022036. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

ACGGCAAGAACTCTCAGGTCTTTAGAAACCCCTACGTGTGGGACTGAGTCAGCGGTGGCGAGGAGAGGCG
GGCGGATTTGGGGAGGGCCCTGAGGACCTGGCCCCGGGCAAGGGACTCTCCAGGCTCCTCCTCCCCCTGG
CAGGCCCAGCAACATGTGCCCCAGATCTGGAAGGGCCTCCCTCTCTGCCAGTGTTTGGGTGGGTGTCATG
GGTGTCCCCACCCACTCCTCAGTGTTTGTGGAGTCGAGGAGCCAACCCCAGCCTCCTGCCAGGATCACCT
CGGCGGTCACACTCCAGCCAAATAGTGTTCTCGGGGTGGTGGCTGGGCAGCGCCTATGTTTCTCTGGAGA
TTCCTGCAACCTCAAGAGACTTCCCAGGCGCTCAGGCCTGGATCTTGCTCCTCTGTGAGGAACAAGGGTG

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_022036.2
Summary The protein encoded by this gene is a member of the type 3 G protein-coupled receptor family. Members of this superfamily are characterized by a signature 7-transmembrane domain motif. The specific function of this protein is unknown; however, this protein may mediate the cellular effects of retinoic acid on the G protein signal transduction cascade. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Locus ID 55890

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.