ALDH4A1 (NM_170726) Human 3' UTR Clone

CAT#: SC205619

3`UTR clone of aldehyde dehydrogenase 4 family member A1 (ALDH4A1) nuclear gene encoding mitochondrial protein transcript variant P5CDhS for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ALDH4A1
• Synonyms: ALDH4; P5CD; P5CDh
• ACCN: NM_170726
• Insert Size: 402
• Sequence Data:
  Insert Sequence

  >SC205619 3'UTR clone of NM_170726
  The sequence shown below is from the reference sequence of NM_170726. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  ACGCGTACATGCAGTGAGCCCCTCTCGGGCTCCACCGTCCAGCTGTCTGTCCGTCCAGATGCCTCCTGCT
  TGGATTCTGAGTGGTCAGAGATCTGTAAAGCATGACTTTCAAGGATGGTTCTTAGGGGACTGTGAAAGTG
  TTGGGTCTTCCTCCAGGATGCCTGCATGGGACCCCACCCGGAGCTGGTGTGGCCATTCCCCAAGTGCCAC
  TGGCCCATGGATGGGGGTGGGTGCTGGTGCCAGCTGGGCTGGGTGTGGGTTCTGTGTCCTTCCAGGATAT
  GTGTCATTTCCCATGAGGGGCCGGGGCAGGTGGCTGGGTGGGGGCACAGGCTGGAGTATTCTTAGTTCTA
  CTGGTTCTACACTGTGAGGTGGCAATGGGATTTGCTCAGATGCCACCCAATA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_170726.2
• Summary: This protein belongs to the aldehyde dehydrogenase family of proteins. This enzyme is a mitochondrial matrix NAD-dependent dehydrogenase which catalyzes the second step of the proline degradation pathway, converting pyrroline-5-carboxylate to glutamate. Deficiency of this enzyme is associated with type II hyperprolinemia, an autosomal recessive disorder characterized by accumulation of delta-1-pyrroline-5-carboxylate (P5C) and proline. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Jun 2009]
• Locus ID: 8659