CAMK1D (NM_020397) Human 3' UTR Clone

CAT#: SC205621

3`UTR clone of calcium/calmodulin-dependent protein kinase ID (CAMK1D) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CAMK1D
• Synonyms: CaM-K1; CaMKID; CKLiK
• ACCN: NM_020397
• Insert Size: 430
• Sequence Data:
  Insert Sequence

  >SC205621 3'UTR clone of NM_020397
  The sequence shown below is from the reference sequence of NM_020397. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GCAAAACCAGAATCCCTCAGCTGACACTGAAGACGAGCCTGGGGTGGAGAGGAGGGAGCCGGCATCTGCC
  GAGCACCTCCTGTTTGCCAGGCGCTTTCTATACTTAATCCCATGTCATGCGACCCTAGGACTTTTTTTAA
  CATGTAATCACTGGGCTGGGTGCAGTGGCTCACGCCTGTAATCCCAACACTTTGGGAGGCTGAGGCAGGA
  GGACTGTTTGAGTTCAGGAGTTTTAAGACCAGCCTGACCAACATGGTGAAACCCCATCTCTACTAAAATA
  TAAAAATTAGCCGGGTGTGGTGGCGAGCACCTGTAATGTCAGCTACTTGGGAGGCTGAGGCAGGAGAATC
  ACTTGAACCCAGGAAGCGGAGGTTGCAATGAGCTGAGATCACACCACTGCACTCCAGCCTGGGTGACAGA
  TTGAGACTCC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_020397.2
• Summary: This gene is a member of the calcium/calmodulin-dependent protein kinase 1 family, a subfamily of the serine/threonine kinases. The encoded protein is a component of the calcium-regulated calmodulin-dependent protein kinase cascade. It has been associated with multiple processes including regulation of granulocyte function, activation of CREB-dependent gene transcription, aldosterone synthesis, differentiation and activation of neutrophil cells, and apoptosis of erythroleukemia cells. Alternatively spliced transcript variants encoding different isoforms of this gene have been described. [provided by RefSeq, Jan 2015]
• Locus ID: 57118