ZNF274 (NM_133502) Human 3' UTR Clone

CAT#: SC205625

3`UTR clone of zinc finger protein 274 (ZNF274) transcript variant ZNF274c for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "ZNF274"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol ZNF274
Synonyms HFB101; ZF2; ZKSCAN19; ZSCAN51
ACCN NM_133502
Insert Size 437
Sequence Data
>SC205625 3'UTR clone of NM_133502
The sequence shown below is from the reference sequence of NM_133502. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GAAACAGCCTACCTCATAGCTCTCAAGCCAGTTGAAGAAACCTTGCCTTTTCAGCTTGACCCTGCAATAT
AACATGCACAGGCCTGCTTGTGAATCAGGACTGAATGTGAAAGGGAAGTATTGAGTGAGGACATTCCCAA
AACCAAAGGACAACTGAGGAGACTGCCCAGCACATAATGAATAAATAAGAAAATGAGTGAGGAGTTATTA
ACATCATTTGGAAAAAAGATTTCCCATTCACTTGATATTGTTTGTTCACTCATTTAGTCATTAAAAGTGA
GATTAATAAAATCTGAAAATGTTATATAATAACTTTAAAAAGCCAGGTAATTAATAATCTGCACTGATAT
TACATCCACAGTACCACAGTATTTATGTGTATGAATTAAGGATTAAAAGATAATGTGGATAAATAAACTA
TTGATCTATGTCTGTGT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_133502.1
Summary This gene encodes a zinc finger protein containing five C2H2-type zinc finger domains, one or two Kruppel-associated box A (KRAB A) domains, and a leucine-rich domain. The encoded protein has been suggested to be a transcriptional repressor. It localizes predominantly to the nucleolus. Alternatively spliced transcript variants encoding different isoforms exist. These variants utilize alternative polyadenylation signals. [provided by RefSeq, Jul 2008]
Locus ID 10782

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.