DPP3 (NM_130443) Human 3' UTR Clone

CAT#: SC205630

3`UTR clone of dipeptidyl-peptidase 3 (DPP3) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: DPP3
• Synonyms: DPPIII
• ACCN: NM_130443
• Insert Size: 427
• Sequence Data:
  Insert Sequence

  >SC205630 3'UTR clone of NM_130443
  The sequence shown below is from the reference sequence of NM_130443. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CCCATCTGGCCAAGCTTGAGGAAGATGTGTGGCCTTGCCCCCAATTCCATCAGACCAAGGCTGCAAGTGG
  CCCTCCATTCGTGTGTGTATTTAGGGGCTGGGGAGGGGGAGGGGCAGGAGCTTGGACCTTGGTACTACCT
  CAGCTGAGGGTGGTGACACAACCCCTTCCATTTGTCAGCACTTTCCAGCCTGCCAATTGCTTCCCCTCTG
  TGATCTCATTTCATCTGCACTGCCATACGTGGAGTGAGCAAGACAGGGCTTACCATCCTGTCTACCAGAT
  GAGGAAATGGCAGTTCTGAGAAGTCACTGGTCTAGATCCCGCAGGTGGCACGTGACAGCTAGGGTTCAAA
  ACGTTCTCACCAAATCCAATGCTCCTCACATATTAATTTTATAACCAGACAAATAAATATTAGAGACAAC
  CACCATC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_130443.2
• Summary: This gene encodes a protein that is a member of the M49 family of metallopeptidases. This cytoplasmic protein binds a single zinc ion with its zinc-binding motif (HELLGH) and has post-proline dipeptidyl aminopeptidase activity, cleaving Xaa-Pro dipeptides from the N-termini of proteins. Increased activity of this protein is associated with endometrial and ovarian cancers. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Feb 2012]
• Locus ID: 10072