ARMCX2 (NM_014782) Human 3' UTR Clone

CAT#: SC205659

3`UTR clone of armadillo repeat containing X-linked 2 (ARMCX2) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ARMCX2
• Synonyms: ALEX2; GASP9
• ACCN: NM_014782
• Insert Size: 445
• Sequence Data:
  Insert Sequence

  >SC205659 3'UTR clone of NM_014782
  The sequence shown below is from the reference sequence of NM_014782. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  ACCTCTTAGTGAAAGTGAAAGTTATAAAACTAGTGAACAAATTCTGATTGGTTATGTACCGTCAAAAGAC
  TTGAAGAAATTTCATGATTTTGCAGTGTGGAAGCGTTGAAAATTGAAAGTTACTGCTTTTCCACTTGCTC
  ATATAGTAAAGGGATCCTTTCAGCTGCCAGTGTTGAATAATGTATCATCCAGAGTGATGTTATCTGTGAC
  AGTCACCAGCTTTAAGCTGAACCATTTTATGAATACCAAATAAATAGACCTCTTGTACTGAAAACATATT
  TGTGACTTTAATCGTGCTGCTTGGATAGAAATATTTTTACTGGTTCTTCTGAATTGACAGTAAACCTGTC
  CATTATGAATGGCCTACTGTTCTATTATTTGTTTTGACTTGAATTTATCCACCAAAGACTTCATTTGTGT
  ATCATCAATAAAGTTGTATGTTTCA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_014782.5
• Summary: This gene encodes a protein containing a potential N-terminal transmembrane domain and multiple armadillo (arm) repeats. Proteins containing arm repeats are involved in development, maintenance of tissue integrity, and tumorigenesis. This gene is located in a cluster of related genes on chromosome X. There is a pseudogene for this gene on chromosome 7. Alternative splicing in the 5' UTR results in multiple transcript variants encoding the same protein. [provided by RefSeq, Aug 2013]
• Locus ID: 9823