ARMCX2 (NM_177949) Human 3' UTR Clone

CAT#: SC205661

3`UTR clone of armadillo repeat containing X-linked 2 (ARMCX2) for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "ARMCX2"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol ARMCX2
Synonyms ALEX2; GASP9
ACCN NM_177949
Insert Size 445
Sequence Data
>SC205661 3'UTR clone of NM_177949
The sequence shown below is from the reference sequence of NM_177949. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

ACCTCTTAGTGAAAGTGAAAGTTATAAAACTAGTGAACAAATTCTGATTGGTTATGTACCGTCAAAAGAC
TTGAAGAAATTTCATGATTTTGCAGTGTGGAAGCGTTGAAAATTGAAAGTTACTGCTTTTCCACTTGCTC
ATATAGTAAAGGGATCCTTTCAGCTGCCAGTGTTGAATAATGTATCATCCAGAGTGATGTTATCTGTGAC
AGTCACCAGCTTTAAGCTGAACCATTTTATGAATACCAAATAAATAGACCTCTTGTACTGAAAACATATT
TGTGACTTTAATCGTGCTGCTTGGATAGAAATATTTTTACTGGTTCTTCTGAATTGACAGTAAACCTGTC
CATTATGAATGGCCTACTGTTCTATTATTTGTTTTGACTTGAATTTATCCACCAAAGACTTCATTTGTGT
ATCATCAATAAAGTTGTATGTTTCA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_177949.2
Summary This gene encodes a protein containing a potential N-terminal transmembrane domain and multiple armadillo (arm) repeats. Proteins containing arm repeats are involved in development, maintenance of tissue integrity, and tumorigenesis. This gene is located in a cluster of related genes on chromosome X. There is a pseudogene for this gene on chromosome 7. Alternative splicing in the 5' UTR results in multiple transcript variants encoding the same protein. [provided by RefSeq, Aug 2013]
Locus ID 9823

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.