RPL13 (NM_000977) Human 3' UTR Clone

CAT#: SC205726

3`UTR clone of ribosomal protein L13 (RPL13) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: RPL13
• Synonyms: BBC1; D16S44E; D16S444E; L13; SEMDIST
• ACCN: NM_000977
• Insert Size: 416 bp
• Sequence Data:
  Insert Sequence

  >SC205726 3'UTR clone of NM_000977
  The sequence shown below is from the reference sequence of NM_000977. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CAAGGAAGCCGCAGAACAGGATGTTGAAAAGAAAAAATAAAGCCCTCCTGGGGACTTGGAATCAGTCGGC
  AGTCATGCTGGGTCTCCACGTGGTGTGTTTCGTGGGAACAACTGGGCCTGGGATGGGGCTTCACTGCTGT
  GACTTCCTCCTGCCAGGGGATTTGGGGCTTTCTTGAAAGACAGTCCAAGCCCTGGATAATGCTTTACTTT
  CTGTGTTGAAGCACTGTTGGTTGTTTGGTTAGTGACTGATGTAAAACGGTTTTCTTGTGGGGAGGTTACA
  GAGGCTGACTTCAGAGTGGACTTGTGTTTTTTCTTTTTAAAGAGGCAAGGTTGGGCTGGTGCTCACAGCT
  GTAATCCCAGCACTTTGAGGTTGGCTGGGAGTTCAAGACCAGCCTGGCCAACATGTCAGAACTACT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_000977.2
• Summary: 'Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L13E family of ribosomal proteins. It is located in the cytoplasm. This gene is expressed at significantly higher levels in benign breast lesions than in breast carcinomas. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2011]'
• Locus ID: 6137