LXR beta (NR1H2) (NM_007121) Human 3' UTR Clone

CAT#: SC205737

3`UTR clone of nuclear receptor subfamily 1 group H member 2 (NR1H2) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: NR1H2
• Synonyms: LXR-b; LXRB; NER; NER-I; RIP15; UNR
• ACCN: NM_007121
• Insert Size: 428 bp
• Sequence Data:
  Insert Sequence

  >SC205737 3'UTR clone of NM_007121
  The sequence shown below is from the reference sequence of NM_007121. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GCCTCTGCTGTCGGAGATCTGGGACGTCCACGAGTGAGGGGCTGGCCACCCAGCCCCACAGCCTTGCCTG
  ACCACCCTCCAGCAGATAGACGCCGGCACCCCTTCCTCTTCCTAGGGTGGAAGGGGCCCTGGGCCGAGCC
  TGTAGACCTATCGGCTCTCATCCCTTGGGATAAGCCCCAGTCCAGGTCCAGGAGGCTCCCTCCCTGCCCA
  GCGAGTCTTCCAGAAGGGGTGAAAGGGTTGCAGGTCCCGACCACTGACCCTTCCCGGCTGCCCTCCCTCC
  CCAGCTTACACCTCAAGCCCAGCACGCAGTGCACCTTGAACAGAGGGAGGGGAGGACCCATGGCTCTCCC
  CCCTAGCCCGGGAGACCAGGGCCTTCCTCTTCCTCTGCTTTTATTTAATAAAAACTAAAAACAGAAACAG
  GAAAATAA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_007121.4
• Summary: 'The liver X receptors, LXRA (NR1H3; MIM 602423) and LXRB, form a subfamily of the nuclear receptor superfamily and are key regulators of macrophage function, controlling transcriptional programs involved in lipid homeostasis and inflammation. The inducible LXRA is highly expressed in liver, adrenal gland, intestine, adipose tissue, macrophages, lung, and kidney, whereas LXRB is ubiquitously expressed. Ligand-activated LXRs form obligate heterodimers with retinoid X receptors (RXRs; see MIM 180245) and regulate expression of target genes containing LXR response elements (summary by Korf et al., 2009 [PubMed 19436111]).[supplied by OMIM, Jan 2010]'
• Locus ID: 7376