Chk1 (CHEK1) (NM_001274) Human 3' UTR Clone

CAT#: SC205740

3`UTR clone of CHK1 checkpoint homolog (S. pombe) (CHEK1) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CHEK1
• Synonyms: CHK1
• ACCN: NM_001274
• Insert Size: 448
• Sequence Data:
  Insert Sequence

  >SC205740 3'UTR clone of NM_001274
  The sequence shown below is from the reference sequence of NM_001274. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TGAGCAGCCAGAAGATTTGGCTTCCTGCCACATGATCGGACCATCGGCTCTGGGGAATCCTGGTGAATAT
  AGTGCTGCTATGTTGACATTATTCTTCCTAGAGAAGATTATCCTGTCCTGCAAACTGCAAATAGTAGTTC
  CTGAAGTGTTCACTTCCCTGTTTATCCAAACATCTTCCAATTTATTTTGTTTGTTCGGCATACAAATAAT
  ACCTATATCTTAATTGTAAGCAAAACTTTGGGGAAAGGATGAATAGAATTCATTTGATTATTTCTTCATG
  TGTGTTTAGTATCTGAATTTGAAACTCATCTGGTGGAAACCAAGTTTCAGGGGACATGAGTTTTCCAGCT
  TTTATACACACGTATCTCATTTTTATCAAAACATTTTGTTTAATTCAAAAAGTACATATTCCATGTTGAT
  TTAATTCTAAGATGAACCAATAAAGACA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_001274.4
• Summary: The protein encoded by this gene belongs to the Ser/Thr protein kinase family. It is required for checkpoint mediated cell cycle arrest in response to DNA damage or the presence of unreplicated DNA. This protein acts to integrate signals from ATM and ATR, two cell cycle proteins involved in DNA damage responses, that also associate with chromatin in meiotic prophase I. Phosphorylation of CDC25A protein phosphatase by this protein is required for cells to delay cell cycle progression in response to double-strand DNA breaks. Several alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Oct 2011]
• Locus ID: 1111