SOCS1 (NM_003745) Human 3' UTR Clone

CAT#: SC205748

3`UTR clone of suppressor of cytokine signaling 1 (SOCS1) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: SOCS1
• Synonyms: CIS1; CISH1; JAB; SOCS-1; SSI-1; SSI1; TIP-3; TIP3
• ACCN: NM_003745
• Insert Size: 441
• Sequence Data:
  Insert Sequence

  >SC205748 3'UTR clone of NM_003745
  The sequence shown below is from the reference sequence of NM_003745. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TCCGCGACTACCTGAGCTCCTTCCCCTTCCAGATTTGACCGGCAGCGCCCGCCGTGCACGCAGCATTAAC
  TGGGATGCCGTGTTATTTTGTTATTACTTGCCTGGAACCATGTGGGTACCCTCCCCGGCCTGGGTTGGAG
  GGAGCGGATGGGTGTAGGGGCGAGGCGCCTCCCGCCCTCGGCTGGAGACGAGGCCGCAGACCCCTTCTCA
  CCTCTTGAGGGGGTCCTCCCCCTCCTGGTGCTCCCTCTGGGTCCCCCTGGTTGTTGTAGCAGCTTAACTG
  TATCTGGAGCCAGGACCTGAACTCGCACCTCCTACCTCTTCATGTTTACATATACCCAGTATCTTTGCAC
  AAACCAGGGGTTGGGGGAGGGTCTCTGGCTTTATTTTTCTGCTGTGCAGAATCCTATTTTATATTTTTTA
  AAGTCAGTTTAGGTAATAAAC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_003745.1
• Summary: This gene encodes a member of the STAT-induced STAT inhibitor (SSI), also known as suppressor of cytokine signaling (SOCS), family. SSI family members are cytokine-inducible negative regulators of cytokine signaling. The expression of this gene can be induced by a subset of cytokines, including IL2, IL3 erythropoietin (EPO), CSF2/GM-CSF, and interferon (IFN)-gamma. The protein encoded by this gene functions downstream of cytokine receptors, and takes part in a negative feedback loop to attenuate cytokine signaling. Knockout studies in mice suggested the role of this gene as a modulator of IFN-gamma action, which is required for normal postnatal growth and survival. [provided by RefSeq, Jul 2008]
• Locus ID: 8651