POLR3GL (NM_032305) Human 3' UTR Clone

CAT#: SC205760

3`UTR clone of polymerase (RNA) III (DNA directed) polypeptide G (32kD)-like (POLR3GL) for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "POLR3GL"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol POLR3GL
Synonyms flj32422; RPC32HOM
ACCN NM_032305
Insert Size 418
Sequence Data
>SC205760 3'UTR clone of NM_032305
The sequence shown below is from the reference sequence of NM_032305. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CTTTGGTGGTGACAGTGATGACAATATGGACGAGGCTATATACTGAAGAAGGACTCTGGACCCTCGTGTC
TTTCTTTAGGATACAGAGAGTAACTGTACCTATTATTTGTTTCTTCAGACAAGCAAATCATTTGGTCAGA
GTTCATATAATCTGTCTGTTCCCTGGAGATGGGAATAGAGGATGATGACAGTTTATTTTCTACACTTCCC
CTCCTTCCACATTTGTATCACCTTTGCTATCTTGGGGAAAGTGCAAAGGACAAACATCTCAATTGTATGA
AGGGAGAAAGGAGAATTGAAAGAAGAACTGGGGTTGTTAGAGCTGAGATGACTGTACACATACCCCTGCC
CAATTTATATAGCTCTTTGTGGAGATAATTAGGGGTGGGAGCAGTTTGAAGGAGTAAGCCTGGTTTTA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_032305.1
Summary DNA-dependent RNA polymerase catalyzes the transcription of DNA into RNA using the four ribonucleoside triphosphates as substrates. Specific peripheric component of RNA polymerase III which synthesizes small RNAs, such as 5S rRNA and tRNAs. [UniProtKB/Swiss-Prot Function]
Locus ID 84265

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.