TAOK2 (NM_016151) Human 3' UTR Clone

CAT#: SC205792

3`UTR clone of TAO kinase 2 (TAOK2) transcript variant 2 for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "TAOK2"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol TAOK2
Synonyms MAP3K17; PSK; PSK1; PSK1-BETA; TAO1; TAO2
ACCN NM_016151
Insert Size 463
Sequence Data
>SC205792 3'UTR clone of NM_016151
The sequence shown below is from the reference sequence of NM_016151. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

AGGTCACGCACCCGCCAGTCCCGGGCCCTGCCCCCCTGGAGGTAGCTGACTCCAGCCCTTCCAGCCCAAA
TCTAGAGCATTGAGCACTTTATCTCCCACGACTCAGTGAAGTTTCTCCAGTCCCTAGTCCTCTCTTTTCA
CCCACCTTCCTCAGTTTGCTCACTTACCCCAGGCCCAGCCCTTCGGACCTCTAGACAGGCAGCCTCCTCA
GCTGTGGAGTCCAGCAGTCACTCTGTGTTCTCCTGGCGCTCCTCCCCTAAGTTATTGCTGTTCGCCCGCT
GTGTGTGCTCATCCTCACCCTCATTGACTCAGGCCTGGGGCCAGGGGTGGTGGAGGGTGGGAAGAGTCAT
GTTTTTTTTCTCCTCTTTGATTTTGTTTTTCTGTCTCCCTTCCAACCTGTCCCCTTCCCCCCACCAAAAA
AAGAAAAAGACAAACACAAATAAAATATCTGAGCGGAACTGTG

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_016151.2
Summary This gene encodes a serine/threonine protein kinase that is involved in many different processes, including, cell signaling, microtubule organization and stability, and apoptosis. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Oct 2011]
Locus ID 9344

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.